Question

ATGAAACTGAGAGCAAGTGTTTTAATCGGTGCGACAATTCTGTGCTTAATTTTAAGCTTGCATGCAGTAATTATGCGAAAAAAGTGGTGAAACAAAAGAACCATGTTTATACGCCTGTGTATAATGAACTGATAGAGGATCCAGTATAGTGAGATACCCTTAAATGACAAACTCAAAGAATCCACACCATTCATGGTGCAAGTGAAGTTGCCAAATTACAAGGACTATTTGTTGGATAATAAACAAGTTCAAGAAGAAAGAGAGAATGAATACTTGCGAAATCAAATCAGAAGTTTGCTCAGTGGTAAGTGA

Write the primer sequence of above gene

Write the Name of Restriction sites where gene( above) can be cloned?( Consider the cloning of this gene in pET 28a Vector for production of complete protein) *​

Answer 1

Answer:

hhieiirlen3grg9e0eo3h

Explanation:

hujwoo3y3j0w

Answer 2

ACTGAGAGCAAGTTAATCGGTGCGACAATTGTTTTAATCGGTGCGACAAT

Explanation:

A primer is a single-stranded, short DNA sequence used in the polymerase chain reaction (PCR). In the PCR procedure, a pair of primers is used to hybridise with the sample DNA and designate the region of the DNA that will be amplified. Oligonucleotides are another name for primers.

A primer is a small set of DNA nucleotides that range in length from 18 to 24 base pairs. A primer can also be employed for a variety of other experimental procedures. Primers can be used in PCR to target a locus and allow for amplification for further study. You'd use a primer for sequencing to target a very specific spot, and then do analysis on the extension of that DNA molecule.