Math, asked by praveenchowdhary826, 4 months ago

1 is a compsite number

Answers

Answered by avnithakur1620

1

Answer:

yes

Step-by-step explanation:

mark me as the brainlist answer plz ✌️

Answered by nehajsr49

0

Answer:

yes

Step-by-step explanation:

Yes 1 is a composite number

Previous Question

Next Question

Similar questions

Computer Science, 2 months ago

Question 1 Consider the assignment that goes with this lesson and its algorithm for finding a gene with stop codon TAA. Consider the following DNA string. • “AAATGCCCTAACTAGATTAAGAAACC” Which one of the following is the gene returned using that algorithm? A)The empty string. B)ATGCCCTAACTAGATTAA C)ATGCCCTAA D)CCC E)ATGCCC...

Chemistry, 2 months ago

a) What is similar about the formula for hydrochloric acid and that for sodium chloride?

Math, 2 months ago

3)Ram scored 344 marks out of 400 marks and his elder brother Ben scored 582 marks out of 600 marks. Who scored percentage is better?

Chemistry, 4 months ago

write the balance chemical equation of zinc with water...

History, 4 months ago

Name the dynasties of Magadha.

Math, 10 months ago

user reminder theorem to find which of the following is factor of 2 x cube + 3 x square - 5 x minus 6 (i) X + 1 (ii)2x-1 (iii)x+2in attachments ...

Math, 10 months ago

- Add a² b² + 4 a² b - 6 a b² +9 & - 4 a² b²+ 2 a² b.

Math, 10 months ago

4a² - ( 4b² + 4bc + c² ) ...