History, asked by Rockalixa, 1 year ago

Bijapur is known for its

A. severe drought condition
B. Gol Gumbaz
C. heavy rainfall
D. statue of Gomateswara

Answers

Answered by Anonymous

3

HELLO DEAR

___________

B. Gol Gumbaz

CORRECT ANSWER

Answered by minal21

2

Hey mate here is ur answer
Gol gumbaz is ryt
Thanks ☺

Previous Question

Next Question

Similar questions

Psychology, 8 months ago

what is arenchyma??

Science, 8 months ago

Q#4: a) what is an ORF? find the ORF from the following sequence, following each step? If you do/ do not find an ORF region what does that means? Also write what is the difference between prokaryotic and eukaryotic ORF sequence? -AATCGGATCTTATATGTTATCCACCTGAGAATCGCGAGGACAGCGCTGCCGGAGTCATGA AAGAAATAAAAGAATGGCGAGCTAAAAATGGCAAGCCGGGATTCAAAACGTAA-...

Science, 8 months ago

how many month does a gestation in human being...

Math, 1 year ago

The length of rectangle, which is 24cm is equal to the length of a square and the area of the rectangle is 176cm less then the area of the square.what is the breadth of the rectangle.

Social Sciences, 1 year ago

Legal Frame work order of August 2002 in Pakistan was not democratic in nature " justify with 3 example " ?

English, 1 year ago

summary of the owl critic by james thomas fields......

Math, 1 year ago

4x^2 + 7x -11 ÷ 2x-4...

Science, 1 year ago

name the two inventions that brought about revolution in the field of transport...