Social Sciences, asked by sarthakpandey7290, 1 year ago

Definition of computer used in film industries

Answers

Answered by vishnu43

3

computer generated imagery (CGI)

Answered by arimakaushik

0

Answer:

A computer is used in film industries for creating realistic animations and editing.

Explanation:

Previous Question

Next Question

Similar questions

Computer Science, 7 months ago

मल्टी टास्किंग फैसिलिटी मीन...

Math, 7 months ago

अपनी भूल के लिए क्षमा याचना करते हुए अपने पिताजी को पत्र लिखिए ।...

Biology, 7 months ago

The sequence of a double stranded DNA, which produces a pentapeptide is given below: 5 TACATGATCATTTCACGGAATTTCTACCATGTA 3 ATGTACTAGTAAAGTGCCTTAAAGATOGTACAT 5 The correct mRNA sequence corresponding to the permapeptide is...

Math, 1 year ago

Definition of compound interest with example...

Science, 1 year ago

Definition of circulation in fluid mechanics...

Math, 1 year ago

greatest 1 digit number...

English, 1 year ago

Active to passive voice. Earth has nothing to show more fare.

Math, 1 year ago

Whic is Smallest 1 digit number...