Question

Describe the primary and secondary structu of dnae

Answer 1

Hiii friend..

Your answer is here...

Hope it help you...

Primary structure: sequence of bases in a strand (e.g., ATTTTCGTAAAGGCGTAAAGGCCTTTGTC….)

Secondary structure: Interactions between bases to form more complex structures. DNA’s secondary structure tends to be a double helix, while RNA often has intramolecular bondind that forms things like hairpin loops, etc.

In other word...

Primary structure , is nothing but the linear,sequencial arrangement of amino acids.

Secondary structure , is the spacial arrangement of primary structure ..

Plz mark my answer as brainliest...