Math, asked by rohit5534715, 1 year ago

eeske baad kya karu A.P ka question he

Attachments:

Answers

Answered by jabirms007

1

Answer:

Sn^2 + 11 n - 156 = 0

Solve this equation

Previous Question

Next Question

Similar questions

Psychology, 6 months ago

what is arenchyma??

Science, 6 months ago

Q#4: a) what is an ORF? find the ORF from the following sequence, following each step? If you do/ do not find an ORF region what does that means? Also write what is the difference between prokaryotic and eukaryotic ORF sequence? -AATCGGATCTTATATGTTATCCACCTGAGAATCGCGAGGACAGCGCTGCCGGAGTCATGA AAGAAATAAAAGAATGGCGAGCTAAAAATGGCAAGCCGGGATTCAAAACGTAA-...

Science, 6 months ago

how many month does a gestation in human being...

Math, 1 year ago

All important questions of chapter 1 class 10...

Physics, 1 year ago

A student has taken equal amount of water and petrol in different classes he kept two glasses on table after one day he observed that some water present in glass and petrol was totally evaporated what is the reason for it ...

Chemistry, 1 year ago

what is a fullform of iupac...

Science, 1 year ago

who is the most Brilliant scientist in world?

Hindi, 1 year ago

fourth maths questions...