Math, asked by netflixlgz, 10 months ago

expand and simplify (x+2) (x+2) (x+2) with working.

Answers

Answered by lucky0386

0

hey mate answer is in the following attachement mark as brainlist please if the answer satisifies u and follow me

Attachments:

Answered by madhav127

0

Answer:

hey bro hope it helpful for u

Attachments:

Previous Question

Next Question

Similar questions

Physics, 5 months ago

I NEED HELP PLEASE!!!!!!!!!!!! HURRY UP PLEASE!!!!!

Biology, 5 months ago

*Q1. You have the following sequence on a plasmid: 5′- ATGCTAGCAGAATTCTAGCTACGAT (only one of the strands is shown) You cleave the region indicated (in bold) with the appropriate restriction enzyme, then fill in the overhangs with DNA polymerase, ligate, and reclone. You then aliquot the resulting DNA to three. In the first tube, digest the plasmid DNA with XmnI (recognition sequence...

English, 5 months ago

plz help me this is due in 30 mins...

English, 10 months ago

On what basis are the recipients two awards selected by the trust formed in the memory of neerja bhanot?

Computer Science, 10 months ago

use if construct to solve the given ternary operator c=(val+500>2000)?0:1:...

English, 1 year ago

what makes your child think that the others will never be able to find him ...

Math, 1 year ago

Factorize 10.2 cube What is the answer of this question...

English, 1 year ago

Sujata Ashtekar and Vatsala Trivedi are two women ……1…… (on / in / with / at) a mission. They spend their time and energy to popularize organ donation in Mumbai. Ashtekar and Trivedi are volunteers ………2….. (at / with / in) the Zonal Transplant Coordination Committee that ………3……. (coordinates / coordinate / coordinating / coordinated), monitors and supervises the cadaver organ transplant...