Biology, asked by ravibipcashamoni, 11 months ago

forward primer sequence and reverse primer sequence of : 5’ ATGCGCGCGC GATGCCGCGC GCGTAAAAAA 3’

Answers

Answered by AditiyarajSaxena

0

Answer:

3' TACGCGCGCGCGTACGGCGCG CGCATTTTTT 5'

Previous Question

Next Question

Similar questions

Science, 5 months ago

which is the smallest element in the group 13 of modern periodic table...

Math, 5 months ago

Plz tell its urgent ...

Computer Science, 5 months ago

What you know about the internet...

Geography, 11 months ago

The strategic difficulties bridge built by border roads is located in which state...

Biology, 11 months ago

The relation between algae and fungi in licten is...

English, 1 year ago

In this line from Thomas Paine's Rights of Man, what element denotes that it is from the Revolutionary era? There exists in man a mass of sense lying in a dormant state, and which, unless something excites it to action, will descend with him, in that condition, to the grave. A. the mention of the grave B. the mention of sense C. the persuasion toward action D. the mention of excitement...

Social Sciences, 1 year ago

How does machiavelli translate absolute morality into absolute pragmatism?

Science, 1 year ago

what happens when paper is burnt...