Biology, asked by ravibipcashamoni, 10 months ago

forward primer sequence and reverse primer sequence of : 5’ ATGCGCGCGC GATGCCGCGC GCGTAAAAAA 3’

Answers

Answered by AditiyarajSaxena

0

Answer:

3' TACGCGCGCGCGTACGGCGCG CGCATTTTTT 5'

Previous Question

Next Question

Similar questions

English, 5 months ago

why did you think aro went through so much trouble and fear to get his kite back ?

Chemistry, 5 months ago

in a water sample co3 ions =90 mg/l Hco3 ions= 61 mg/l what is alkalinity of the water sample in mg/l...

Biology, 5 months ago

What are the organelles present in a cell ...

Geography, 10 months ago

The strategic difficulties bridge built by border roads is located in which state...

Biology, 10 months ago

The relation between algae and fungi in licten is...

English, 1 year ago

In this line from Thomas Paine's Rights of Man, what element denotes that it is from the Revolutionary era? There exists in man a mass of sense lying in a dormant state, and which, unless something excites it to action, will descend with him, in that condition, to the grave. A. the mention of the grave B. the mention of sense C. the persuasion toward action D. the mention of excitement...

Social Sciences, 1 year ago

How does machiavelli translate absolute morality into absolute pragmatism?

Science, 1 year ago

what happens when paper is burnt...