English, asked by rehan7419, 1 year ago

have you taken my money ? change it into simple past interrogative

Answers

Answered by alex985

0

Did you took my money?

varun000: did k saath second form nhi lgte

Answered by varun000

0

Simple past:

" DID YOU TAKE MY MONEY? "

harpreet2233: kida ambarsar walio

varun000: o, ap hme jnte hain ji?

harpreet2233: hnjii

varun000: kse

Previous Question

Next Question

Similar questions

Political Science, 7 months ago

the fundamental rights are content in which parts of the Indian Constitution?

Math, 7 months ago

What is 4 pie r square -pie r square?

Social Sciences, 7 months ago

Asteroids are found between the orbits of 1 point (i) Saturn and Jupiter (ii) Mars and Jupiter (iii) The Earth and Mars (iv)Mercury and Venus...

Math, 1 year ago

can to give 8 one answer...

Biology, 1 year ago

If the sequence of one strand of DNA is written as follows: TACGTACGTACGTACGTACGT ACGTACG write down the sequence of complementary stand in 5’—3′. If the sequence of the coding strand in a transcription unit is written as follows: 5′ ATGC ATGCATGCA TGC ATGC ATGCATGC—3′ write down the sequence of complementary strand in RNA.

Math, 1 year ago

each of the two equal angles of an isosceles triangle is twice the third angle find the angles of the triangle...

Music, 1 year ago

when the one direction come back again?

Physics, 1 year ago

what is speed ? and 4 characteristics...