English, asked by rathodganesh, 1 month ago

how to stop ourself from wasting time ?

Answers

Answered by aditdwivedi336

1

Answer:

S.to.p using br.ainly.

Unin.s.tall it now.

Answered by priyayadavyadav59

0

Answer:

hlw ganesh .this is your name

right how are you

Previous Question

Next Question

Similar questions

Geography, 16 days ago

where is india please answer...

Physics, 16 days ago

Different between in weightlessness space and weightlessness in the earth...

Geography, 16 days ago

Assertion(A): We need a standard meridian Reason(R): India is situated from west to east in about 30 longitudes. It takes 4 minutes to cross a longitude...

English, 1 month ago

Two thirds of the work --- left. are Ο Ο. is has O were...

Math, 1 month ago

e.simplify the question- (4÷2 - 10 ÷ 5) ÷3...

Biology, 9 months ago

The sequence of a double stranded DNA, which produces a pentapeptide is given below: 5 TACATGATCATTTCACGGAATTTCTACCATGTA 3 ATGTACTAGTAAAGTGCCTTAAAGATOGTACAT 5 The correct mRNA sequence corresponding to the permapeptide is...

Science, 9 months ago

cholera is caused by ?

Science, 9 months ago

explain the process of harvesting...