Math, asked by arjumanreshma, 1 year ago

I I want answer right now please correct give me answer

Attachments:

Answers

Answered by yuvi753176

1

Answer:

how can we answer this

Answered by mokshita1081

0

Answer:

C) 5 gold and 2 silver cards

Previous Question

Next Question

Similar questions

Biology, 6 months ago

22. Read the sequence of the nucleotides in the given segment of mRNA and the respective amino acid sequence in the polypeptide chain AUGUUUAUGCCUGUUUCUUAA mRNA. (i) Provide the triplet of bases (codon) for (a) valine (b) proline (ii) Write the nucleotide sequence of the DNA strand from which this mRNA was transcribed.

Math, 6 months ago

104) The average cost of 4 watches is Rs. 230.. If one watch is lost, the average cost of 3 watches become rs 185 What is the cost of the watch which is lost? (A) Rs. 265 (B) Rs. 330 (C) Rs. 365 (D) Rs. 310...

Math, 6 months ago

Q. No. (1) : 11, 23, 48, 99, ? , 409 202 200 201 205 please tell with solution ...

Environmental Sciences, 1 year ago

what is rural economics...

Geography, 1 year ago

What are the ill effects of an invasive species like water hyacinth? i. Blockage of sunlight from reaching native aquatic plants. ii. Starving the water of carbon dioxide iii. Domination and phasing out of fish and other native species. iv. Change in the water quality with respect to the dissolved oxygen and the water pH due to release of CO2 . v. Starving the water of oxygen. vi.

Physics, 1 year ago

Please solve it fast...

Physics, 1 year ago

Answer this physics question!!?

Math, 1 year ago

please sove this question ...