Biology, asked by shan9403395, 5 months ago

ii. Assume the following base sequence was found in a 20 base DNA strand:
3ATTCGACCTTATTACTGCAC5

(a) What would be the first 5 bases in the 3 end of the complementary strand?
(b) What would be the 10 bases of the 5 end of the complementary strand?

Answers

Answered by arshadhussain8746

1

Answer:

a. GTGCA

b. TAAGCTGGAA

Previous Question

Next Question

Similar questions

Hindi, 2 months ago

दो दो शब्द लिखे आका ...

Chemistry, 2 months ago

star mation 17) When magnesium is burnt, heat and light are produced. The burning of magnesium is a a China di O Reversible change ara O Exothermic chemical change om O Endothermic chemical change O Temporary change ki...

Biology, 2 months ago

What is active transport? Differniate between active and passive transport?

Social Sciences, 5 months ago

1. Draw pictures of different modes of worship and prepare a small booklet on it for your school library.

Social Sciences, 5 months ago

State affecting the factor climate...

History, 11 months ago

two features of IC analysis...

English, 11 months ago

"Mrs. Hutchinson? Oh, Mrs. Hutchinson." Thelma batted her eyes. "Naw, precious, she come on Thursday and didn't ev'n mention your name. I doubt if she ev'n knows you're on the way." "Thelma!" cried Leota staunchly. In this excerpt from "The Petrified Man," why does Leota get upset at Thelma's comment? Leota does not want Thelma to distract her customer with idle gossip. Mrs. Fletcher does...

Hindi, 11 months ago

किताब खरीदने के लिए अपने पिता se एक हजार का माग karo...