Computer Science, asked by radheyshyam221980, 7 months ago

मल्टी टास्किंग फैसिलिटी मीन

Answers

Answered by jeetshahgamer26

1

Answer:

pata nahi bhai sorry pata hota toh bata deta sorry

Previous Question

Next Question

Similar questions

Chemistry, 3 months ago

which of the following is incorrecy rms velocity...

Chemistry, 3 months ago

define atomic radius and explain its variation along the group and across the period in the periodic table...

English, 3 months ago

question ke answer kr kr ke thak gyi.... lol ...

Math, 7 months ago

अपनी भूल के लिए क्षमा याचना करते हुए अपने पिताजी को पत्र लिखिए ।...

Biology, 7 months ago

The sequence of a double stranded DNA, which produces a pentapeptide is given below: 5 TACATGATCATTTCACGGAATTTCTACCATGTA 3 ATGTACTAGTAAAGTGCCTTAAAGATOGTACAT 5 The correct mRNA sequence corresponding to the permapeptide is...

Physics, 11 months ago

longitudinal waves are classified as...

Biology, 11 months ago

Carbohydrates in the plants are stored in the form of....??

Environmental Sciences, 11 months ago

green India clean india...