Computer Science, asked by radheyshyam221980, 9 months ago

मल्टी टास्किंग फैसिलिटी मीन

Answers

Answered by jeetshahgamer26

1

Answer:

pata nahi bhai sorry pata hota toh bata deta sorry

Previous Question

Next Question

Similar questions

Math, 4 months ago

Get the algebraic expressions using variables, constants and arithmetic operations. One- fourth of the sum of numbers m and n...

Science, 4 months ago

23. What is the characteristic of the kingdom Fungi with regard to: Presence or absence of a distinct nucleus. (ii) Unicellular or multi-cellular. (iii) Mode of feeding.

Math, 4 months ago

6. एक आयताकार भूखंड के बाड़ की लंबाई 100 मी है। यदि भूखंड की लंबाई 35 मी हो तो उस भूखंड का क्षेत्रफल ज्ञात कीजिए। ...

Math, 9 months ago

अपनी भूल के लिए क्षमा याचना करते हुए अपने पिताजी को पत्र लिखिए ।...

Biology, 9 months ago

The sequence of a double stranded DNA, which produces a pentapeptide is given below: 5 TACATGATCATTTCACGGAATTTCTACCATGTA 3 ATGTACTAGTAAAGTGCCTTAAAGATOGTACAT 5 The correct mRNA sequence corresponding to the permapeptide is...

Physics, 1 year ago

longitudinal waves are classified as...

Biology, 1 year ago

Carbohydrates in the plants are stored in the form of....??

Environmental Sciences, 1 year ago

green India clean india...