Mention the differences in the synthesis of protein, based on the polarity of the two template strands
Answers
There is a convention in defining the two strands of the DNA in the structural gene of a transcription unit. Since the two strands have opposite polarity and the DNA-dependent RNA polymerase also catalyse the polymerisation in only one direction, that is, 5
′
to 3
′
.
The strand that has the polarity 3
′
to 5
′
acts as a template, and is also referred to as template strand. The other strand which has the polarity (5
′
to 3
′
) and the sequence same as RNA (except thymine at the place of uracil), is displaced during transcription. Strangely, this strand (which does not code for anything) is referred to as coding strand.
All the reference point while defining a transcription unit is made with coding strand. To explain the point, a hypothetical sequence from a transcription unit is represented below:
3
′
−ATGCATGCATGCATGCATGCATGC−5
′
Template Strand
5
′
−TACGTACGTACGTACGTACGTACG−3
′
Coding Strand
A transcription unit in DNA is defined primarily by the three regions in the DNA:
(i) A Promoter
(ii) The Structural gene
(iii) A Terminator