History, asked by devyanshichoudhari23, 2 months ago

please send urgently
don't send spam ​

Attachments:

Answers

Answered by nehabhagirath23618
0

rajput

Explanation:

राजपूत कौन सा सॉरी नहीं नेम द इंपॉर्टेंस ऑफ

Answered by vinaysharma58
1

A1. the Chola Empire stretched from the island of Sri Lanka in the south to the Godavari-Krishna river basin in the north, up to the Konkan coast in Bhatkal, the entire Malabar Coast (the Chea country) in addition to Lakshadweep, and Maldives.

I know only this much so PLZ so sorry I cant help u further.

PLZ MARK ME AS BRAINLIEST!!!!!!!!!!!!!

Previous Question
Next Question
Similar questions
Science, 1 month ago
ii. Assume the following base sequence was found in a 20 base DNA strand: 3ATTCGACCTTATTACTGCAC5 a.. What would be the first 5 bases in the 3 end of the complementary strand? b.. What would be the 10 bases of the 5 end of the complementary strand? ​
Math, 1 month ago
0.) Identin the solids whose nets are given below. c) b) d)​...
Math, 1 month ago
a bag contains cards numbered from 1 to 49. a card is drawn from the bag at random. find the probability that the card drawn is a) natural number less than 50 b) a number x such that 50<x<100.​
Science, 2 months ago
Explain why the leaves only emerge once the growing shoot is above the ground?​
Science, 2 months ago
Practice: Use the Gizmo to create stable compounds from the combinations given below. After transferring electrons, arrange the atoms to demonstrate the attraction between positively charged ions and negatively charged ions. Click Check to check each compound. Write the chemical formula on a separate piece of paper and insert picture here. Ionic charges Chemical formula A. Lithium and...
English, 8 months ago
you are Manish/Maya a resident of Dariba Kalan, Chandi Chowk, Delhi. you can't bear the noise pollution caused for the religious purposes. Write a letter to the Editor of a national daily highlighting an urgent need for putting a blanket ban on the use of loud speaker at night for religious purposes.​
Computer Science, 8 months ago
are short program codes used to automate tasks in MS Access. es​...
Physics, 8 months ago
differentiate between magnetic and non magnetic subtance​...