Math, asked by gaurqvanand123, 3 months ago

pls answr it quickly

Attachments:

Answers

Answered by garvparihar15

1

it will be 1

as (√3)² will be 3 and (√3)-² will be 1/3 so they will cancel.

please mark it as brainliest..

Previous Question

Next Question

Similar questions

Physics, 1 month ago

I NEED HELP PLEASE!!!!!!!!!!!! HURRY UP PLEASE!!!!!

Biology, 1 month ago

*Q1. You have the following sequence on a plasmid: 5′- ATGCTAGCAGAATTCTAGCTACGAT (only one of the strands is shown) You cleave the region indicated (in bold) with the appropriate restriction enzyme, then fill in the overhangs with DNA polymerase, ligate, and reclone. You then aliquot the resulting DNA to three. In the first tube, digest the plasmid DNA with XmnI (recognition sequence...

English, 1 month ago

plz help me this is due in 30 mins...

Math, 3 months ago

find the number of cube of edge length 8 centimeters that can be obtained by melting an iron cube of edge length 40 cm?

Social Sciences, 3 months ago

3) Which famous sculpture is there in the Elephanta caves?

Math, 8 months ago

increase 130 Rupees by 8%...

Math, 8 months ago

plz answer this question...

Hindi, 8 months ago

. जब बाढ़ आती है तो जल की कोई सीमा नहीं होती, वह विध्वंस करता है। लेकिन जब उसी जल को कोई बांध नियंत्रित करता है, तो वह जनकल्याण के लिए जलविद्युत उत्पादन गृह में या सिंचाई हेतु प्रयोग किया जा सकता है। यदि हम इस जल की तुलना मन से करें, तो कौन सा विकल्प सही है? (गीता-6.6) क. अनियंत्रित मन बाढ़ के जल के समान है, गनियंत्रित मन एक बांध के समान है, वह विध्वंस का कारण बनता है तथा जिसका उपयोग जनकल्याण...