Computer Science, asked by rahulkumarsingh63771, 6 months ago

Question 1 Which one of the following is the first gene for this strand of DNA where you want to consider all three of the stop codons? ""AATGCTAACTAGCTGACTAAT

Answers

Answered by munusamy614
6

Answer:

डठठठडफफठछछचचटटटटटफबडडठफशबाचृबटढोऑ

Previous Question
Next Question
Similar questions
Environmental Sciences, 3 months ago
Which tissue has chloroplast in cells?
Music, 3 months ago
2. 2070 2011 2008 - (2up ANAMBRA STATE UNIVERSITY, ULI CHEMISTRY DEPARTMENT Second semester 2012/2014 1. br 30 mins CHM 172: BASIC PRACTICAL CHEMISTRY II Answer three questions 1. kuu Y XWUM What confirmatory tests would you carry out to distinguish between the following Starch and glucose Iron II and Iron III Water and sodium chloVide solution Trioxonitrate (V) (NO) and Nitrogen (IV) Oxide (NO2)...
Math, 3 months ago
Brian gets £x wages each week. After he pays his tax of £x, he then pays is rent of £220. He shares what's left between himself and his wife. How much do they each get?
English, 6 months ago
Dipen could not catch the ball he drop them...
Biology, 6 months ago
Cyton,dendrite,plasma,axon which one odd out...
Political Science, 10 months ago
Write any four features of behaviouralism.
Political Science, 10 months ago
Political Science is a science. Give arguments in favour of this statement.
Political Science, 10 months ago
Which topics should be included in the scope of Political science as per UNESCO ? OR Explain the scope of Political Science from the point of view of UNESCO. Which topics were included in the scope of Political Science during the Paris Conference of UNESCO ? OR Which type of subject matter can be included is the scope of traditional Political Science according to UNESCO ?