Computer Science, asked by rahulkumarsingh63771, 6 months ago

Question 1 Which one of the following is the first gene for this strand of DNA where you want to consider all three of the stop codons? ""AATGCTAACTAGCTGACTAAT

Answers

Answered by munusamy614

6

Answer:

डठठठडफफठछछचचटटटटटफबडडठफशबाचृबटढोऑ

Previous Question

Next Question

Similar questions

Geography, 3 months ago

Type the correct answer in the box. Spell all words correctly. Consider the terms pyramid, line, square, and triangle. The term_____ is not defined in Euclidean geometry.

Math, 3 months ago

I'm not good at math so I was wondering if anyone knew the answer to this one...

Business Studies, 3 months ago

Discuss (with examples) the environmental forces that affect the company’s ability to serve its customers.

English, 6 months ago

Dipen could not catch the ball he drop them...

Biology, 6 months ago

Cyton,dendrite,plasma,axon which one odd out...

Political Science, 11 months ago

Write any four features of behaviouralism.

Political Science, 11 months ago

Political Science is a science. Give arguments in favour of this statement.

Political Science, 11 months ago

Which topics should be included in the scope of Political science as per UNESCO ? OR Explain the scope of Political Science from the point of view of UNESCO. Which topics were included in the scope of Political Science during the Paris Conference of UNESCO ? OR Which type of subject matter can be included is the scope of traditional Political Science according to UNESCO ?