Computer Science, asked by rahulkumarsingh63771, 5 months ago

Question 1 Which one of the following is the first gene for this strand of DNA where you want to consider all three of the stop codons? ""AATGCTAACTAGCTGACTAAT

Answers

Answered by munusamy614

6

Answer:

डठठठडफफठछछचचटटटटटफबडडठफशबाचृबटढोऑ

Previous Question

Next Question

Similar questions

Chemistry, 2 months ago

3. Nitre was more essiential than water for principle of vegetation , proved by - (a) Glauber (b) Wallerius (c) DJ Hissink (d) Thomas ...

English, 2 months ago

(6x³-17x²+6x-7)÷(2x-3...

English, 2 months ago

و He said , shut the door ,change. the narration ...

English, 5 months ago

Dipen could not catch the ball he drop them...

Biology, 5 months ago

Cyton,dendrite,plasma,axon which one odd out...

Political Science, 10 months ago

Write any four features of behaviouralism.

Political Science, 10 months ago

Political Science is a science. Give arguments in favour of this statement.

Political Science, 10 months ago

Which topics should be included in the scope of Political science as per UNESCO ? OR Explain the scope of Political Science from the point of view of UNESCO. Which topics were included in the scope of Political Science during the Paris Conference of UNESCO ? OR Which type of subject matter can be included is the scope of traditional Political Science according to UNESCO ?