Biology, asked by situj688, 4 months ago

Suppose a cDNA has the sequence CTTAGGA. What is the corresponding mRNA sequence?

A. GAATCCT

B. GAAUCCU

C. AGGATTC

D. UCCUAAG
justify your answer

Answers

Answered by navsharma767

0

Answer:

D. UCCUAAG

The sequence of the mRNA is 5' AUGGCAACCCAGGGUAGUUUG 3' ... d. The third codon is 5' ACC 3'. Therefore, the corresponding anti-codon is 5' ...

Previous Question

Next Question

Similar questions

Science, 2 months ago

An …………………… is an electrically warmed box inside which a substance can be kept at a desired temperature.

Math, 2 months ago

16. Find the class mark of the class 200 - 250.

Math, 2 months ago

A girl bought 25 m cloth. She used 5 m 80 cm for making a table cloth, 2 m 5 cm for a rack cover and 12 m 45 cm for window curtains. How much of cloth did she use in all and how much of cloth is left with her?

Economy, 4 months ago

if APC=1.2 ,then what is value of APS ...

Math, 4 months ago

state the quadrant in which theta lies if tan theta less than 0 and setheta more than ...

Science, 9 months ago

14. How did coal come into existence in nature?

English, 9 months ago

They must have left the keys behind. change the sentence into passive voice...

Math, 9 months ago

Two coins are tossed 400 times and we get Twoheads : 112 times , one head : 160 times, 0 head: 128 times. when two coins are tossed at random, what is the probability of getting a. 2heads? b. 1 head ? c. 0 head ?