History, asked by twinkle95, 1 year ago

what do you mean by De-urbanisation. short answer plz.

Answers

Answered by Anonymous

5

$\huge\red{HELLO\:FRIEND}$

De-urbanisation >> De- urbanisation men's the destruction or end of old towns and cities.

May this helps you

Anonymous: oh that's really great

twinkle95: from where r u?

Anonymous: i am from My heart

Anonymous: heheheh

Anonymous: what happens ji

Anonymous: ???

Anonymous: good morning

Anonymous: good morning

Anonymous: how are you

Anonymous: ??

Previous Question

Next Question

Similar questions

Science, 6 months ago

Q#4: a) what is an ORF? find the ORF from the following sequence, following each step? If you do/ do not find an ORF region what does that means? Also write what is the difference between prokaryotic and eukaryotic ORF sequence? -AATCGGATCTTATATGTTATCCACCTGAGAATCGCGAGGACAGCGCTGCCGGAGTCATGA AAGAAATAAAAGAATGGCGAGCTAAAAATGGCAAGCCGGGATTCAAAACGTAA-...

Science, 6 months ago

how many month does a gestation in human being...

Physics, 6 months ago

Does doubling the height that an object must fall as it rolls down a ramp double the acceleration?

Math, 1 year ago

the angle of elevation of the top of Tower a b from a point x on a ground is 60 degree at up at a point Y 40 m vertically above X the angle of elevation of top is 45 degree find the height of the tower a b and distance x b...

Math, 1 year ago

Pls olve the third question...

English, 1 year ago

Hey friends!!!! ☺ ✔ Write an essay with proper vocabulary using idioms with spamming on the following topic : ⏩ You encounter a celebrity whom you admire a lot and wished to meet from a long time. Narrate your feelings and how u spent time with him/her. ⏪ Please don't regard an actress or an actor as a celebrity in this essay. Instead, regard a sportsman or sportsman or a singer as a celebrity...

Geography, 1 year ago

how the islands are formed...

Math, 1 year ago

Which number will you multiply with 35 to get the double of the product of 35 and 5...