Math, asked by simransharma15, 8 months ago

What is the amount of divedend received per share of face value rs 50 if dividend declared is 40%

Option
A) ₹10
B)₹20
C)₹30
D)₹40

Answers

Answered by EmperorSoham

7

Answer:

Hello my friend

Your answer is B ₹20

Answered by sanikamagdum

11

Answer:

B . 20

Step-by-step explanation:

divided amount =40% of FV

= 40/100*50

= 4*5

= 20

Previous Question

Next Question

Similar questions

Math, 4 months ago

(cosA+ sinA)^2 + (cos A -sin A)^2 =2...

Psychology, 4 months ago

what is arenchyma??

Science, 4 months ago

Q#4: a) what is an ORF? find the ORF from the following sequence, following each step? If you do/ do not find an ORF region what does that means? Also write what is the difference between prokaryotic and eukaryotic ORF sequence? -AATCGGATCTTATATGTTATCCACCTGAGAATCGCGAGGACAGCGCTGCCGGAGTCATGA AAGAAATAAAAGAATGGCGAGCTAAAAATGGCAAGCCGGGATTCAAAACGTAA-...

Physics, 8 months ago

What will be the nature of the image formed in a convex mirror and in a concave mirror each of focal length 20 cm and object is placed at the distance of 10 cm.

Science, 8 months ago

what is the electricity is generated...

Math, 10 months ago

Find the LCM of k, 2k, 3k, 4k and 5k...

Math, 10 months ago

find the angle which is equal to it's complement .

Science, 10 months ago

what are the I'll effects of tobacco alcohol smoking on the digestive system...