Biology, asked by nerpnerp, 10 months ago

What is the opposite strand of DNA for the following:
CATGTGCAGTATGTTACGTGGGGACTAAA

Answers

Answered by vlakshmipriya46

0

Answer:

RNA

Explanation:

RNA is also an source of DNA

Answered by thenotorious3

0

Rna..........:):):):)

Previous Question

Next Question

Similar questions

Economy, 5 months ago

Calculate the A.M of the following data using step deviation method. (4) Marks (below) 10 20 30 40 50 60 70 80 Students 15 35 60 84 96 127 198 250...

Social Sciences, 5 months ago

how to conduct election during covid 19 pandemic ...

English, 5 months ago

Did you join them for dinner at least? (change to future continuous tense)...

Math, 10 months ago

solve for k k/2 + 1/2 = 3...

Science, 10 months ago

i need some help in all of my homework...

Physics, 1 year ago

Two identical resistance of 12 ohm each are connected to a battery of three volt elected the ratio of the power consumed by the resulting combination with the minimum resistance resistance...

Math, 1 year ago

The sum of the zeroes of the polynomial 4x²-x-4 is?

Computer Science, 1 year ago

A compiler in computing means– (a) A programmer. (b) A person who compiles source program. (c) Keypunch operator (d) A gaming software (e) A program which translates source program into object program...