Math, asked by ashokkunarguptagupta, 5 days ago

what should be the least number by which when 23808 be divided,the quotient may be a perfect square?

tell me it's right answer.

Answers

Answered by virajsingh123

1

Answer:

I love you I love you I love you I love you I love you I love you ❤️

Answered by sunitadevi32196

0

93 answer plz give me two star

Previous Question

Next Question

Similar questions

Science, 2 days ago

A fungus rich in vitamin B. * Yeast Truffle Penicillium...

Math, 2 days ago

40 comes in between 38 and 39...

English, 2 days ago

Convert into Indirect Speech : 19. Ravi said, "He likes the book." 20. Radha says, "I am a teacher." 21. I said to him, "Where are you going ?" 22. She said, "God is omnipresent."...

Computer Science, 5 days ago

Question 1 Consider the assignment that goes with this lesson and its algorithm for finding a gene with stop codon TAA. Consider the following DNA string. • “AAATGCCCTAACTAGATTAAGAAACC” Which one of the following is the gene returned using that algorithm? A)The empty string. B)ATGCCCTAACTAGATTAA C)ATGCCCTAA D)CCC E)ATGCCC...

Chemistry, 5 days ago

a) What is similar about the formula for hydrochloric acid and that for sodium chloride?

Biology, 7 months ago

what is cellular respiration ???

Business Studies, 7 months ago

Explain why is it challenging to innovate, design and develop services?

Physics, 7 months ago

A transparent medium of lower refractive index is also called...