Science, asked by thangjamdhiren123, 7 months ago

when does the development of skeleton reaches its completion

Answers

Answered by hrisheekeshmnair7g

Answer:

The development of our bones is a complex process. Bone formation starts in the fetus 6 months before birth and is not generally complete until adolescence (between ages 13 and 18)

Explanation:

Previous Question

Next Question

Similar questions

English, 3 months ago

Choose the option that completes the given sentence meaningfully. The new sidewalk should make it safer to walk _____ the highway ____ night. 1 across...during 2 across...in 3 along...at 4 along...in answer please.

Physics, 3 months ago

what is combination of circuit...? (answer should be long the long and satisfying anwer will be marked as brainlist)...

Biology, 3 months ago

ii. Assume the following base sequence was found in a 20 base DNA strand: 3ATTCGACCTTATTACTGCAC5 (a) What would be the first 5 bases in the 3 end of the complementary strand? (b) What would be the 10 bases of the 5 end of the complementary strand?

Computer Science, 7 months ago

a website is collection of ghraphics files it is true or false...

Hindi, 7 months ago

8. गृह कार्य समय से पूरा ना करने वाले छात्र और अध्यापक का संवाद लगभग 70 से 80 शब्दों में लिखिए। (5)...

Psychology, 11 months ago

what is prediction in psychology...

Biology, 11 months ago

what are the characterstics of connective tissue...

Sociology, 11 months ago

make a time table for 10 standard student with include 2 hours 30 min tuition ...

when does the development of skeleton reaches its completion​

Answers

when does the development of skeleton reaches its completion