Science, asked by nehamitusrivastava23, 10 months ago

why pumpkin are not ingredients of preparing chicken curry? explain

Answers

Answered by arjunb963

1

Answer:

Pumpkin is very sweet.

Explanation:

It doesnt offer contrast well enough to make it a combo.

Previous Question

Next Question

Similar questions

Computer Science, 5 months ago

Q1) Difference between computer virus and human virus ? Q2) What is the use of Boolean operator ? Q3) Express AND,OR and NOT table with all condition ? Q4) Heyan lost his computer materials and he has decided to download those materials from educational website.Suggest him what process he has to follow to get those materials for downloading stepwise ?

Math, 5 months ago

A man walking at the speed of 1km/h in 30 mins he will walk:-________.help meee fasttt...

Biology, 5 months ago

is hydrogen chlorine and oxygen are covalent compound?

Biology, 10 months ago

write three advantages of selecttive preamble...

Biology, 10 months ago

Look at the following short strand of DNA: CCTGTATGTTCTGAATAATGCTTATGCCTAATGAC What is the first gene found in it?

Music, 1 year ago

hi friends I want a conversation for students for school...

Hindi, 1 year ago

Write a paragraph on speed kills..

Science, 1 year ago

adakah kita tidak boleh membasuh rambut,meminum air sejuk dan memakan ais krim atau bersukan semasa haid?jelaskan jawapan anda.