Science, asked by nehamitusrivastava23, 9 months ago

why pumpkin are not ingredients of preparing chicken curry? explain

Answers

Answered by arjunb963

1

Answer:

Pumpkin is very sweet.

Explanation:

It doesnt offer contrast well enough to make it a combo.

Previous Question

Next Question

Similar questions

Math, 4 months ago

In ∆ ABC, AC = 4 cm, CB = 6 cm and DC = 1 cm. Find the length of AB. 1. 8 cm 2. 10 cm 3. 12 cm 4. 14 cm ...

English, 4 months ago

letter to the manager of a shop for the service of your instrument. ( Radio, mobile, computer) love from me..Help plss...

Hindi, 4 months ago

hand translate in hindi...

Biology, 9 months ago

write three advantages of selecttive preamble...

Biology, 9 months ago

Look at the following short strand of DNA: CCTGTATGTTCTGAATAATGCTTATGCCTAATGAC What is the first gene found in it?

Music, 1 year ago

hi friends I want a conversation for students for school...

Hindi, 1 year ago

Write a paragraph on speed kills..

Science, 1 year ago

adakah kita tidak boleh membasuh rambut,meminum air sejuk dan memakan ais krim atau bersukan semasa haid?jelaskan jawapan anda.