India Languages, asked by ilina, 1 year ago

চৈয়দ আব্দুল মালিকৰ মৃতু্্য কিমান চনত হৈছিল

Answers

Answered by varunsai33k

0

Answer:

ഢ് എന്ന നിലയിൽ ഒരു ഗൈഡ് ജില്ലാ റാലി ചരിത്ര €76 8

Explanation:

99

Answered by Anonymous

2

চৈয়দ আব্দুল মালিকৰ জন্ম ২০০০ চনত হৈছিল

Previous Question

Next Question

Similar questions

Biology, 7 months ago

ii. Assume the following base sequence was found in a 20 base DNA strand: 3ATTCGACCTTATTACTGCAC5 (a) What would be the first 5 bases in the 3 end of the complementary strand? (b) What would be the 10 bases of the 5 end of the complementary strand?

Social Sciences, 7 months ago

1. Draw pictures of different modes of worship and prepare a small booklet on it for your school library.

Social Sciences, 7 months ago

State affecting the factor climate...

English, 1 year ago

why did the seeds should be not shown in dry soil ...

Hindi, 1 year ago

please do this fastly in hindi ...

English, 1 year ago

Descriptive email about festival you recently attended...

Math, 1 year ago

three angles of a quadrilateral are equal and the fourth angle is 144 degree .find each of the equal angles of the quadrilateral...

Math, 1 year ago

please answer this quest 21...