Question

2. What will be the sequence of the transcribed RNA molecule from given double stranded DNA segment? Define the polarity of these two strands as well as of the transcribed mRNA. CGATGCCTAACGACATGCGTCATTGG GCTACGGATTGCTGTACGCAGTAACC​

Answer 1

Transcription of DNA results in a mRNA encoding at least one gene. The mRNA however, serve as a template for protein synthesis through translation. Transcription unit is a specific section of DNA which is transcribed into mRNA. The transcription unit has three main parts;a promoter, a structural gene and a terminator.