Math, asked by vishalhindigaming3, 10 days ago

MCOS 6. In n th 1. Zinc and Nickel are melted and mixed together in the ratio 10:17. What is the weight of the melted mixture, if 30 kg of Zinc has been consumed in it? a) 51 kg b) 79 kg c) 81 kg d) 210 kg a c 7.

Answers

Answered by aritramal00

0

Answer:

81 kg

Step-by-step explanation:

please mark me as brainliest

Answered by sutariyapankaj10

0

81 kg

hope it helps you.

mark as brainlist

Previous Question

Next Question

Similar questions

Geography, 5 days ago

What is globe? What is a shape of it?

Math, 5 days ago

The ratio of the heights of a cone and a cylinder is 2 : 1 and the ratio of the radii of their bases is 3:1 respectively. Find the ratio of their volumes. : Please answer...

Math, 5 days ago

derivative of 2+3^-2+9...

Biology, 10 days ago

2. What will be the sequence of the transcribed RNA molecule from given double stranded DNA segment? Define the polarity of these two strands as well as of the transcribed mRNA. CGATGCCTAACGACATGCGTCATTGG GCTACGGATTGCTGTACGCAGTAACC...

Math, 10 days ago

what is the additive inverse of rational number -p upon q solution ...

English, 8 months ago

picture composition of this picture write 100-120 words.Spammers will be reported...

Hindi, 8 months ago

क्या आपको लगता है कि पक्षी भी मनुष्य की तरह bwavon को महसूस करते हैं कैसे...

Math, 8 months ago

3 3 the midnight temprature of delhi in the month of december was 10° C drophed by 4°C in the next three hours. What has the temprature after 6 hours it...