Hindi, asked by shristi3895, 3 days ago

मुझे ध्वनि पाठ में क्या चुनौतीपूर्ण लगा ?

Answers

Answered by preetiup50

3

Answer:

How can we tell you what's in your mind?

Previous Question

Next Question

Similar questions

Biology, 1 day ago

do blood flows through the kidney is equal to blood filtrate...

Physics, 1 day ago

9. A uniform disc rotating freely about a vertical axis passing through its centre makes 90 rpm. A small piece of wax of mass 10g falls vertically on the disc and sticks to it at a distance of 5 cm from its axis. If the frequency is thus reduced to 60rpm, find the moment of Inertia of the disc.

Math, 1 day ago

A petrol pump owner mixed leaded and unleaded petrol in such a way that the mixture contai 10 % unleaded petrol. What quantity of leaded petrol should be added to 1 litre mixture so that the percentage of unleaded petrol becomes 5%...

Math, 3 days ago

MCOS 6. In n th 1. Zinc and Nickel are melted and mixed together in the ratio 10:17. What is the weight of the melted mixture, if 30 kg of Zinc has been consumed in it? a) 51 kg b) 79 kg c) 81 kg d) 210 kg a c 7.

Biology, 3 days ago

2. What will be the sequence of the transcribed RNA molecule from given double stranded DNA segment? Define the polarity of these two strands as well as of the transcribed mRNA. CGATGCCTAACGACATGCGTCATTGG GCTACGGATTGCTGTACGCAGTAACC...

Math, 8 months ago

find the zeroes of px=2(x2-3)+x...

English, 8 months ago

picture composition of this picture write 100-120 words.Spammers will be reported...

Hindi, 8 months ago

क्या आपको लगता है कि पक्षी भी मनुष्य की तरह bwavon को महसूस करते हैं कैसे...