Biology, asked by shivangisingh269, 1 year ago

A cistronic DNA strand had the following and base sequence: A T G C G G C T A G A A T A T T C C A T G G C C. What would be the base sequence of the mRNA transcribed from it?

Answers

Answered by niteeshzeus2001

6

Answer:

just opposite

Explanation:

convert A to T and G to C

tacgccgatcttataaggtaccgg

hope you got it

please mark as brainliest

Answered by gellisurabhi

2

Answer:

The sequence of bases in RNA is UACGCCGAUCUUAUAAGGUACCGG

Be Brainly

Previous Question

Next Question

Similar questions

Physics, 6 months ago

A car moving with uniform accelaration and changes in velocity from 10m/s tob50m/s in 4 second.find out the accelaration of the car and find displacement in time ...

Math, 6 months ago

In which case of the following lengths of sides of a triangle, is it possible to draw a triangle? (2 Points) 3 cm, 4 cm, 7 cm 2 cm, 3 cm, 7 cm 3 cm, 4 cm, 5 cm...

Hindi, 6 months ago

अलंकार पहचानो और नाम लिखी: चारु चंद्र की चंचल किरण, खेल रही थी जल थल तब तो बहता सभम शिला-सा जम जायेगा बरसत, बारिद, बूंद काली वटा का का घमंड चटा करें कवि वेनी, बनी व्याल कीचुराईलीनी रुपति शबव राजा राम तीन बरबाती पी वी तीन बेर खाती थी...

Science, 1 year ago

An element 'A' has valency +3 while another element 'B' has valency -2. Give the formula of their compound formed when A reacts with B.

Math, 1 year ago

maths used in hydraulic bridge...

Political Science, 1 year ago

How mane part of over country...

Math, 1 year ago

A gym has yoga classes. Each class has 13 students. If there are c classes, write an equation to represent the total number of students s taking yoga.

Chemistry, 1 year ago

X mmol of KIO3 reacts completely with Y mmol of KI to give I2 quantitatively. If Z mmol of hypo(Na2S2O3) are required for complete titration against this I2 then which relation is not correct ? A. Z = 6X B. 6Y = 5Z C. X = 5Y D. X + Y = 2Z. Please give detailed Answer.....