Math, asked by sly44688, 3 months ago

A gardener has 1000plants . he wants to planta these in such a way that the number of rows and number of columns remain same . find the minimum number of plants he needs more for this.

Answers

Answered by adi038

0

i dont know i cannot help you man

Previous Question

Next Question

Similar questions

Biology, 1 month ago

26. कौनसा कथन सही नहीं है? (1) हेटेरोक्रोमेटिन अधिक सघनता से पैक होता है। (2) DNA प्रतिकृतिकरण 3'→5' दिशा में होता है। (3) इन्ट्रॉन नॉन-कोडिंग अनुक्रम है (4) DNA अम्लीय प्रकृति रखता है। । rep null nudu, Samrathpura opp. Shripad Residency, Palanpore Canal Road Bunglo ...

English, 1 month ago

Q1Birds have only one set of feathers? Q2 the bigger the bird is the more feathers it has on its body ...

English, 1 month ago

Rajju is tallest___ boy in the class. w The Rich should help_____ -poor- VII) He mustered____ courage and climbed X apple a day keeps doctor away...

Math, 3 months ago

How many non perfect square numbers are there between 15^2 and 16^2?

Science, 3 months ago

impact in education skills and work...

Biology, 10 months ago

Look at the following short strand of DNA: CCTGTATGTTCTGAATAATGCTTATGCCTAATGAC What is the first gene found in it?

Biology, 10 months ago

What is the meaning of membership...

Computer Science, 10 months ago

mention 3 attitudes of self control and low confident people ...