English, asked by singhsurinder197100, 3 months ago

Hlo guys don't deleted the question plz plz plz plz plz plz plz plz plz plz plz plz ​

Answers

Answered by AliaAlve20
8

Answer:

what is the name if reward did thimmakha receive from the prime Minister

Answered by brainly1900
2

Answer:

ok

please mark me as brainliest

and flw me

Previous Question
Next Question
Similar questions
Math, 1 month ago
never never never why should I give you points huhh! app with bad quality​...
Science, 1 month ago
what are contact force and non contact force ?​
English, 1 month ago
I worked hard in order that I _ achieve success.[might, should]​...
Math, 3 months ago
A gardener has 1000plants . he wants to planta these in such a way that the number of rows and number of columns remain same . find the minimum number of plants he needs more for this.​
Math, 3 months ago
How many non perfect square numbers are there between 15^2 and 16^2?​
Biology, 10 months ago
write three advantages of selecttive preamble​...
Biology, 10 months ago
Look at the following short strand of DNA: CCTGTATGTTCTGAATAATGCTTATGCCTAATGAC What is the first gene found in it?
Biology, 10 months ago
What is the meaning of membership...