Math, asked by uttu6158, 1 year ago

A piece of board 8 m by 6 m is cut into 12 squares, find the perimeter of square

Answers

Answered by suraj19545

2

see the solution and try your self...after understanding this

Attachments:

Previous Question

Next Question

Similar questions

Psychology, 6 months ago

what is arenchyma??

Science, 6 months ago

Q#4: a) what is an ORF? find the ORF from the following sequence, following each step? If you do/ do not find an ORF region what does that means? Also write what is the difference between prokaryotic and eukaryotic ORF sequence? -AATCGGATCTTATATGTTATCCACCTGAGAATCGCGAGGACAGCGCTGCCGGAGTCATGA AAGAAATAAAAGAATGGCGAGCTAAAAATGGCAAGCCGGGATTCAAAACGTAA-...

Science, 6 months ago

how many month does a gestation in human being...

Math, 1 year ago

If 10 men (or) 18 boys can do a piece of work in 15 days, then 15 men and 13 boys together will do twice the work in...

Physics, 1 year ago

A simple pendulum of length 1 m is oscillating with a new angular frequency 10 rads...

Hindi, 1 year ago

please answer this question!!

Geography, 1 year ago

the tropical evergreen forest in brazil is so enormous that it is like the lungs of the earth ? Can u tell why ?

History, 1 year ago

Describe in short the event of 14 july 1789...