Geography, asked by Anonymous, 7 months ago

After how many years can Halley's comet be seen a) 76
b) 66
c) 56
d)87

Answers

Answered by harsitamsingh2006

0

Answer:

the correct answer is 75 or 76

Answered by riyasonwane

0

Answer:

your option is incorrect hope may it help you

Explanation:

a) 75 years

Previous Question

Next Question

Similar questions

Science, 3 months ago

ii. Assume the following base sequence was found in a 20 base DNA strand: 3ATTCGACCTTATTACTGCAC5 a.. What would be the first 5 bases in the 3 end of the complementary strand? b.. What would be the 10 bases of the 5 end of the complementary strand?

Math, 3 months ago

0.) Identin the solids whose nets are given below. c) b) d)...

Math, 3 months ago

a bag contains cards numbered from 1 to 49. a card is drawn from the bag at random. find the probability that the card drawn is a) natural number less than 50 b) a number x such that 50<x<100.

English, 7 months ago

Please rewrite the sentences in passive voice ...

Math, 7 months ago

Which is the following expression of the equal to -30...

Physics, 11 months ago

the velocity of a particle moving in the positive direction of x-axis varies as we equal to K root x draw v-t graph...

English, 11 months ago

He usually... in his bath . sing ,sangs...

Science, 11 months ago

what is sexual reproduction...