CBSE BOARD X, asked by shasha5, 1 year ago

anybody have sa1 exam paper for class 9th so plz give me its very important

evelyn1: but ky aap mjh y btaoge ki m upload kse kru
shasha5: pic click krke
evelyn1: or haa m av 9th m hu n 14 ko mra exam hua tha maths ka to usi ka h exam paper h mre pas
shasha5: ans de dijiye plz
shasha5: okk
shasha5: which school
evelyn1: government
shasha5: name
evelyn1: aap mjh chat m ek msg krdo then m apko pic bhj dungi
evelyn1: sant.eknath sarvodaya kanya vidyalaya

Answers

Answered by evelyn1
1
see this is the question paper
Attachments:
Previous Question
Next Question
Similar questions
Psychology, 9 months ago
what is arenchyma??​
Science, 9 months ago
Q#4: a) what is an ORF? find the ORF from the following sequence, following each step? If you do/ do not find an ORF region what does that means? Also write what is the difference between prokaryotic and eukaryotic ORF sequence? -AATCGGATCTTATATGTTATCCACCTGAGAATCGCGAGGACAGCGCTGCCGGAGTCATGA AAGAAATAAAAGAATGGCGAGCTAAAAATGGCAAGCCGGGATTCAAAACGTAA-...
Science, 9 months ago
how many month does a gestation in human being...
Physics, 1 year ago
Examples of commonly used gadgets or devices which are based on the principles of Newton's law of motion...
Biology, 1 year ago
Flat paded foot ,hairy fleshy lips I have hump to store water ,I am the ship of the desert ,who am I,...
Environmental Sciences, 1 year ago
how traffic causes air pollution?
Environmental Sciences, 1 year ago
when does water pollution happen?
Environmental Sciences, 1 year ago
how to reduce of water pollution?