Computer Science, asked by vinayakdev959, 1 month ago

find the following identifiers valid or not. if invalid write the reason.
a. Throw
b. Else
c. True
d. M. Salary
e. $Bill
f. 8m
g. Cout
h. MAIN
i.Implement
j. package

Java question
Wrong = ban
please help

Answers

Answered by Anonymous2102

0

Answer:

?????????????????????

Explanation:

Previous Question

Next Question

Similar questions

English, 16 days ago

what is the use of litmus paper...

English, 16 days ago

Q38. Why did the teacher ask everyone to go back to their seat? wanda...

Science, 16 days ago

define different types of heat ...

Hindi, 1 month ago

Write any three advantages of mixed culture of food and changes in cuisines over the years.

Social Sciences, 1 month ago

what is biggest content...

Computer Science, 9 months ago

मल्टी टास्किंग फैसिलिटी मीन...

Math, 9 months ago

अपनी भूल के लिए क्षमा याचना करते हुए अपने पिताजी को पत्र लिखिए ।...

Biology, 9 months ago

The sequence of a double stranded DNA, which produces a pentapeptide is given below: 5 TACATGATCATTTCACGGAATTTCTACCATGTA 3 ATGTACTAGTAAAGTGCCTTAAAGATOGTACAT 5 The correct mRNA sequence corresponding to the permapeptide is...