Computer Science, asked by vinayakdev959, 2 months ago

find the following identifiers valid or not. if invalid write the reason.
a. Throw
b. Else
c. True
d. M. Salary
e. $Bill
f. 8m
g. Cout
h. MAIN
i.Implement
j. package

Java question
Wrong = ban
please help

Answers

Answered by Anonymous2102

0

Answer:

?????????????????????

Explanation:

Previous Question

Next Question

Similar questions

Math, 1 month ago

What sum will amount to rs 12400 in 2 years at 12% per annum ...

Social Sciences, 1 month ago

name four tourist places of Kolkata .

English, 1 month ago

why does lomov have difficulty going to sleep ?

Hindi, 2 months ago

Write any three advantages of mixed culture of food and changes in cuisines over the years.

Social Sciences, 2 months ago

what is biggest content...

Computer Science, 11 months ago

मल्टी टास्किंग फैसिलिटी मीन...

Math, 11 months ago

अपनी भूल के लिए क्षमा याचना करते हुए अपने पिताजी को पत्र लिखिए ।...

Biology, 11 months ago

The sequence of a double stranded DNA, which produces a pentapeptide is given below: 5 TACATGATCATTTCACGGAATTTCTACCATGTA 3 ATGTACTAGTAAAGTGCCTTAAAGATOGTACAT 5 The correct mRNA sequence corresponding to the permapeptide is...