Math, asked by manshasharma872, 9 months ago

hi simplify this question

Attachments:

Answers

Answered by VedankMishra

0

Answer:

= 20 ÷ 32× 64

1.6×64 = 102.4

Previous Question

Next Question

Similar questions

Hindi, 4 months ago

Who is the prime minister of INDIA.

Biology, 4 months ago

write the important events occurring in the phases of meiosis 2...

Math, 4 months ago

b) In a library, there are 430 books in a rack. How many books will be there in 2 such racks?

Economy, 9 months ago

In monopoly firm the numbers of firm is..................................

Computer Science, 9 months ago

Consider the assignment that goes with this lesson and its algorithm for finding a gene with stop codon TAA. Consider the following DNA string. “AAATGCCCTAACTAGATTAAGAAACC” Which one of the following is the gene returned using that algorithm?

Biology, 1 year ago

the ___________ are an exception to cell theory ...

Math, 1 year ago

What will be the numbers of zeros in the square of the following numbers A 400 B 1000 c600...

Physics, 1 year ago

dimensional formula of force...