Economy, asked by gladynag824, 9 months ago

In monopoly firm the numbers of firm is..................................

Answers

Answered by josexjosex2

1

Answer:

1

Explanation:

it occurs only one firm

Answered by deviv8390

3

Explanation:

In monopoly firm the numbers of firm is _single _....

Previous Question

Next Question

Similar questions

English, 4 months ago

(B3) Match the words in column ‘A’ with its antonyms in column 'B': A' "B' i. Frowned a. ii. scattered b. spread grinned smiled gathered C. d.

Physics, 4 months ago

अन्दरा परमाणु बलिया के लिए सूत्र स्वापित कीजिए ।...

Hindi, 4 months ago

वाद-विवाद में कौम-सा समास है ? * 1 point द्विगु समास द्वंद्व समास कर्मधारय समास अव्ययीभाव समास ...

Computer Science, 9 months ago

Consider the assignment that goes with this lesson and its algorithm for finding a gene with stop codon TAA. Consider the following DNA string. “AAATGCCCTAACTAGATTAAGAAACC” Which one of the following is the gene returned using that algorithm?

Geography, 9 months ago

How is the title important in a map?

Biology, 1 year ago

the ___________ are an exception to cell theory ...

Math, 1 year ago

What will be the numbers of zeros in the square of the following numbers A 400 B 1000 c600...

Physics, 1 year ago

dimensional formula of force...