English, asked by parmardiwakar, 7 months ago

how does Dr Chanda react and what does he suggest Bipin Babu should do?

Answers

Answered by deepag0410

1

Explanation:

which chapter are u talking

leave like and mark me. as brainilist

Previous Question

Next Question

Similar questions

Math, 3 months ago

2xy + 4уz - xyz pls solve this...

Science, 3 months ago

rolling friction is _______than the sliding friction ...

Geography, 3 months ago

please answer please please ...

Science, 7 months ago

who invented exam?

Biology, 7 months ago

Assume you are using PCR (polymerase chain reaction) to make multiple copies of a target gene. The primers that flank the gene are 5'ATGTT3' and 3'CCATT5'. The DNA sequence containing the gene of interest is: 3' TACAAAGACTTACAAATTTGTCCCCATTTTGC 5' 5' ATGTTTCTGAATGTTTAAACAGGGGTAAAACG 3' Answer the following questions to describe the overall process and insert the diagran of the results you would...

Science, 11 months ago

a balloon is full of water Jenny wants to make a hole in the balloon so that the water comes out at the maximum pressure at which point should he make the whole and why ...

Geography, 11 months ago

___________ resources found all over the world...

Chemistry, 11 months ago

How Does Evaporation Cause Cooling ?