Science, asked by kumarashok7693193, 8 months ago

who invented exam?

Answers

Answered by bhuvithapliyal6

Answer:

Hii

Explanation:

Exams were made by Henry A. Fischel

Answered by LEGEND778

Answer:

Henry Fischel

Explanation:

' If we were to go by historical sources, then exams were invented by an American businessman and philanthropist known as Henry Fischel somewhere in the late 19th century. However, some sources attribute the invention of standardized assessments to another man by the same name, i.e. Henry Fischel.

pls mark as brainliest answer

Previous Question

Next Question

Similar questions

Environmental Sciences, 4 months ago

Can we keep on drawing water from underground?How will it effect the water table?

English, 4 months ago

Shall we go to school tomorrow? Underline the subject and predicate in the following sentences.

English, 4 months ago

My question is that write a dialogue between a doctor and a child (patient) discussing the disadvantages of eating junk food...

Biology, 8 months ago

Assume you are using PCR (polymerase chain reaction) to make multiple copies of a target gene. The primers that flank the gene are 5'ATGTT3' and 3'CCATT5'. The DNA sequence containing the gene of interest is: 3' TACAAAGACTTACAAATTTGTCCCCATTTTGC 5' 5' ATGTTTCTGAATGTTTAAACAGGGGTAAAACG 3' Answer the following questions to describe the overall process and insert the diagran of the results you would...