Biology, asked by Hardeep6785, 1 year ago

If the sequence of the coding strand in a transcription unit is written as follow :5' atgcatgcatgcatgcatgcatgcatgc3'.write down the sequence of mrna

Answers

Answered by rs797573

1

5'AUGCAUGCAUGCAUGCAUGCAUGCAUGC.3'
This is the anwer of yur question mate .
Hopeful

Thnks

Previous Question

Next Question

Similar questions

Math, 7 months ago

None of than Fill in the blanks (5) term is assumed as universal truth in all branches of Mathematics (6) Euclid divides his famous treatist elements into chepters, cach called a book. (7) Zero of the polynomial P(x) = 4 Iris...

Chemistry, 7 months ago

Calculate Z and V for ethylene at 25°C and 12 bar by the following equations: (a) The truncated virial equation [Eq. (3.38)] with the following experimental values of virial coefficients: B = −140 cm 3 ·mol −1 C = 7200 cm 6 ·mol −2 (b) The truncated virial equation [Eq. (3.36)], with a value of B from the generalized Pitzer correlation [Eqs. (3.58)–(3.62)] (c) The Redlich/Kwong equation (d) The...

English, 7 months ago

.........the clothes have been washed...

Math, 1 year ago

If there are 15 distinct points on a plane what is the maximum no of straight lines...

Science, 1 year ago

how much is the cost of 1000x microscope...

Environmental Sciences, 1 year ago

Explain how rainwater harvesting can help in water conservation?

Math, 1 year ago

find the value of k for which polynomial x power 24 - 4 x power to 2 + 2 X + K to arrs is zero...

Science, 1 year ago

which phenomenon take place in a periscope which enables a person to see the objects over the heads of people in a crowd...