Math, asked by Sahil1067, 1 year ago

If the sum of a number and its reciprocal be 2 then the number is

Answers

Answered by RiskyJaaat

0

If the sum of a number and its reciprocal be 2/1

before reciprocal 1/2

Previous Question

Next Question

Similar questions

Math, 7 months ago

er the following questions: Find the LCM and GCD for 40 a' b?, 25a' b' and verify that S(x)*g(x) = LCM GCD 25 whose GCD is a? - 7a + 10...

Economy, 7 months ago

How does unemployment affect the growth of a nation? pls answer my question......class 9 economics i will mark u as brainliest...

Math, 7 months ago

find five rational numbers between 2/3 and 4/5...

Physics, 1 year ago

If the speed of a dc motor increases with load torque then it is a...

Biology, 1 year ago

If the sequence of the coding strand in a transcription unit is written as follow :5' atgcatgcatgcatgcatgcatgcatgc3'.write down the sequence of mrna...

Science, 1 year ago

What do you mean by Hallucination ?

Environmental Sciences, 1 year ago

Explain how rainwater harvesting can help in water conservation?

Math, 1 year ago

find the value of k for which polynomial x power 24 - 4 x power to 2 + 2 X + K to arrs is zero...