Question

ii. Assume the following base sequence was found in a 20 base DNA strand:
3ATTCGACCTTATTACTGCAC5
a.. What would be the first 5 bases in the 3 end of the complementary strand?
b.. What would be the 10 bases of the 5 end of the complementary strand? ​

Answer 1

suscribe my channel royal gamer aman rai

Answer:

All things are transient in life. Whether it’s success or failure, happiness or miseries nothing is permanent. Even life itself is transitory. Crying is not the only solution for our problems. Crying will not bring the things for us for which we cry, instead if we try our best we might get what we desire.

It is not always possible to be happy or successful. It is a fact that if we want to get something, we have to face hurdles. However, there are many people who break down at the slightest strike. Everyone wants to be happy or successful. However, one does not realize that it is not possible to be successful or happy all the time. There will be ups and down in life. Even when we are successful there will be critics. So, when we meet failure instead of cursing our destiny and crying, it is better to fight back the situation. We should go on trying till we achieve the thing we dream of. However, if we are failing it does never mean that we don’t have potential. It just might be that our attempt was not in the right direction.

Failure is not ultimate. We must not forget the story of Robert Bruce and the spider. Instead of sitting back after failure and repenting, he tried and fought back with courage, and he won. We should not accept life as it comes to us. Why not try and see one more time? We should have faith on our potential. Thomas A. Edison said “our greatest weakness lies in giving up. The most certain way to succeed is always to try just one more time.”

Explanation: