Math, asked by kamaloli, 4 months ago

The book price written as Rs 60.If the commission is 10% still seller gets profit of 20% .Find the cost price of the book?

Answers

Answered by deveshanaria

0

Answer:

I hope you helpful

please Mark me brainlaist

Attachments:

Answered by UDGG

0

Answer:

₹42

Step-by-step explanation:

total sp of book = ₹60

commission % = 10%

profit % = 20%

cp of book = 60 - ( 60×30/100)

= 60 - 18

= ₹42

Previous Question

Next Question

Similar questions

Math, 2 months ago

it took a family 3.75 hours to drive 232.8 miles. find his average mile/hour speed.

English, 2 months ago

Write an email to your sister telling her about your new boarding school. You can add details about your teachers, mode of studies, class mates and co-curricular activities? tell me answer Please ...

Math, 2 months ago

a fish lays brown eggs or white eggs and it likes to lay them in a certain pattern. each brown eggs are surrounded by 6 white eggs. here there are 3 brown eggs and 14 white eggs.

Science, 4 months ago

ii. Assume the following base sequence was found in a 20 base DNA strand: 3ATTCGACCTTATTACTGCAC5 a.. What would be the first 5 bases in the 3 end of the complementary strand? b.. What would be the 10 bases of the 5 end of the complementary strand?

Math, 4 months ago

0.) Identin the solids whose nets are given below. c) b) d)...

Math, 10 months ago

If the sum of zeroes of the polynomial 3×2-kx+6 is 3 , then the value of ...

Math, 10 months ago

find 20 rational number between -1 and 2...

Biology, 10 months ago

. 2. Protoplasm is present in living...