Computer Science, asked by amiteshr046, 4 months ago

iska ans bhejiye jaldi se

Attachments:

Answers

Answered by cjdjdkei

1

A option is correct answer

Previous Question

Next Question

Similar questions

Math, 2 months ago

what should be the least number by which when 23808 be divided,the quotient may be a perfect square? tell me it's right answer.

Computer Science, 2 months ago

Question 1 Consider the assignment that goes with this lesson and its algorithm for finding a gene with stop codon TAA. Consider the following DNA string. • “AAATGCCCTAACTAGATTAAGAAACC” Which one of the following is the gene returned using that algorithm? A)The empty string. B)ATGCCCTAACTAGATTAA C)ATGCCCTAA D)CCC E)ATGCCC...

Chemistry, 2 months ago

a) What is similar about the formula for hydrochloric acid and that for sodium chloride?

English, 4 months ago

we (be) a teacher since 2004. correct tense...

English, 4 months ago

convet into indirect speech. what can we do to teach a lesson to china? a Student asked Mr. Suthat "Have you seen Sonum wangchuy's video?" "Yes, sir . Sonam appeal the indian people to Boycotel Chinese products" "you are right follow 'Be Indian, by Indian? Products 17...

Social Sciences, 10 months ago

what is Prudential power sharing ?

English, 10 months ago

Who wrote this new book? Change it into passive voice...

Math, 10 months ago

Divide the sum of (13/5) and (-12/7) by the product of (-31/7) and (-1/2)...