Psychology, asked by tarunpuppala4158, 1 year ago

Its part of the human condition to want to share things thoughts, ideas, opinions. (paulo coelho)

Answers

Answered by Anonymous

0

Paulo Coelho Quotes. Writing means sharing. It's part of the human condition to want to share things - thoughts, ideas, opinions. ·

Previous Question

Next Question

Similar questions

Math, 7 months ago

write the degree of (x2+1)(x3+1)2 ...

Hindi, 7 months ago

दिए गए उपसर्ग और शब्दो से 10 नए शब्द बनाओ...

Biology, 7 months ago

If the height of a child is 1.45 m. Express it into cm and mm...

English, 1 year ago

Give list of english essay topics...

Sociology, 1 year ago

Is that complex whole which includes knowledge belief art morals law custom and any other capabilities and habits acquired by hu man s as a member of society?

Biology, 1 year ago

If the sequence of one strand of DNA is written as follows: TACGTACGTACGTACGTACGT ACGTACG write down the sequence of complementary stand in 5’—3′. If the sequence of the coding strand in a transcription unit is written as follows: 5′ ATGC ATGCATGCA TGC ATGC ATGCATGC—3′ write down the sequence of complementary strand in RNA.

Math, 1 year ago

by using HCF find the LCM of 989 and 1892...

English, 1 year ago

sentence about request, utter, trouble...