Psychology, asked by tarunpuppala4158, 11 months ago

Its part of the human condition to want to share things thoughts, ideas, opinions. (paulo coelho)

Answers

Answered by Anonymous

0

Paulo Coelho Quotes. Writing means sharing. It's part of the human condition to want to share things - thoughts, ideas, opinions. ·

Previous Question

Next Question

Similar questions

English, 6 months ago

hii Do this sentences in Sanskrit Please give me answers ...

Math, 6 months ago

what is terminating and non repeating ?? give examples...

Social Sciences, 6 months ago

On the world map locate: (a) One Iron deposit in China (b) One Bauxite deposit in North Australia (c) Coal deposit in Russia (d) Natural Gas deposits in USA...

English, 11 months ago

Give list of english essay topics...

Sociology, 11 months ago

Is that complex whole which includes knowledge belief art morals law custom and any other capabilities and habits acquired by hu man s as a member of society?

Biology, 1 year ago

If the sequence of one strand of DNA is written as follows: TACGTACGTACGTACGTACGT ACGTACG write down the sequence of complementary stand in 5’—3′. If the sequence of the coding strand in a transcription unit is written as follows: 5′ ATGC ATGCATGCA TGC ATGC ATGCATGC—3′ write down the sequence of complementary strand in RNA.

Math, 1 year ago

by using HCF find the LCM of 989 and 1892...

English, 1 year ago

sentence about request, utter, trouble...