English, asked by CharlottyLama9919, 1 year ago

How many such pairs of letters are there in the word preamble each of which has as many letters between them as in the english alphabet?

Answers

Answered by mehrin20

0

Answers: get answer of How many such pairs of letters are there in the word PREAMBLE, each of which has as many letters between them in the word.

Previous Question

Next Question

Similar questions

Math, 6 months ago

write the degree of 5xyz...

Biology, 6 months ago

Find out the type of organisms growing on the bread...

English, 6 months ago

convert in active voice. 3. This monument was built by Emperor Ashoka.

Psychology, 1 year ago

Its part of the human condition to want to share things thoughts, ideas, opinions. (paulo coelho)...

English, 1 year ago

Give list of english essay topics...

Biology, 1 year ago

If the sequence of one strand of DNA is written as follows: TACGTACGTACGTACGTACGT ACGTACG write down the sequence of complementary stand in 5’—3′. If the sequence of the coding strand in a transcription unit is written as follows: 5′ ATGC ATGCATGCA TGC ATGC ATGCATGC—3′ write down the sequence of complementary strand in RNA.

Math, 1 year ago

by using HCF find the LCM of 989 and 1892...

English, 1 year ago

sentence about request, utter, trouble...