Geography, asked by ramanandyadav968, 1 year ago

Which physical feature of india is formed by the interplay of thrre major river systems and explain its formation?

Answers

Answered by shradharay2002

Answer:The interplay of three major river systems – the Indus, the Ganga, the Brahmaputra and their tributaries formed a fertile, flat land of extensive alluvial deposits known as the Northern Plains.

Explanation:

Previous Question

Next Question

Similar questions

Geography, 6 months ago

2. Peter weighs 45kilograms and 1.58meters tall. What is his body mass index?

Social Sciences, 6 months ago

tamil language is very tough india ,.!? a)yes b)No...

Physics, 6 months ago

light ,and reflection of lights defination ...

English, 1 year ago

How many such pairs of letters are there in the word preamble each of which has as many letters between them as in the english alphabet?

Psychology, 1 year ago

Its part of the human condition to want to share things thoughts, ideas, opinions. (paulo coelho)...

Math, 1 year ago

can to give 8 one answer...

Biology, 1 year ago

If the sequence of one strand of DNA is written as follows: TACGTACGTACGTACGTACGT ACGTACG write down the sequence of complementary stand in 5’—3′. If the sequence of the coding strand in a transcription unit is written as follows: 5′ ATGC ATGCATGCA TGC ATGC ATGCATGC—3′ write down the sequence of complementary strand in RNA.

Math, 1 year ago

by using HCF find the LCM of 989 and 1892...