English, asked by amarkhobragade97, 1 month ago

Prepare word chain using Verb react

Answers

Answered by Deepikagill

1

Your Answer!

=> Terminate

=> Eating

=>Grossing

=>Gauge

=>Etc....

Answered by mahadeobandkar

0

Answer:

React - Tremble - Eat - Talk - knot - Teach.

Explanation:

Hope it's helpful...!!!

Please mark me as a brainliest

Previous Question

Next Question

Similar questions

Science, 18 days ago

give answers with explanation...

Physics, 18 days ago

which of the following does not give the unit of energy...

Math, 18 days ago

) वह सबसे बड़ी संख्या निकालिए जिससे यदि 162, 382 और 877 को भाग दे तो पूरा-पूरा भाग लगने के लिए हरेक हालत में 3 की कमी रह जाती हैं?

Accountancy, 1 month ago

(6) Journalise the following transaction in the books o go 2020 Feb. 1 Feb. 5 Feb. 6 Feb. 7 Paid Salary * 5,000. Received commission 2.000. Received Rent 4,000. Paid interest on capital 4,000. Received interest on Drawings * 400. Paid wages * 2,000 to Rahul. Paid * 10,000 to Raman on account. Feb. 8 Feb. 15 Feb. 20...

English, 1 month ago

how to stop ourself from wasting time ?

Math, 9 months ago

अपनी भूल के लिए क्षमा याचना करते हुए अपने पिताजी को पत्र लिखिए ।...

Biology, 9 months ago

The sequence of a double stranded DNA, which produces a pentapeptide is given below: 5 TACATGATCATTTCACGGAATTTCTACCATGTA 3 ATGTACTAGTAAAGTGCCTTAAAGATOGTACAT 5 The correct mRNA sequence corresponding to the permapeptide is...

Science, 9 months ago

cholera is caused by ?