English, asked by pratyakshakhare560, 5 months ago

problems in implementing library automation

Answers

Answered by ramdassingh2019

Answer:

Answered by Harshabadboy

Answer:

The Survey revealed that two libraries surveyed face several problems such as inadequacy of infrastructure and hardware, problems in the software, lack of trained and skilled staff and lack of funds. The study makes recommendations to overcome these problems and achieve successful automation.

Hope this helps ❤❤

Previous Question

Next Question

Similar questions

Math, 2 months ago

what should be the least number by which when 23808 be divided,the quotient may be a perfect square? tell me it's right answer.

Computer Science, 2 months ago

Question 1 Consider the assignment that goes with this lesson and its algorithm for finding a gene with stop codon TAA. Consider the following DNA string. • “AAATGCCCTAACTAGATTAAGAAACC” Which one of the following is the gene returned using that algorithm? A)The empty string. B)ATGCCCTAACTAGATTAA C)ATGCCCTAA D)CCC E)ATGCCC...

Chemistry, 2 months ago

World Languages, 5 months ago

Read the following passage carefully and answer the questions that follow: Internet can be compared to a big city full of attractions and diversions. But like a big city, the internet has its dark byways and risky neighbourhoods. You need to know how to skirt round them- especially if there are young people in your household. If you use a public computer to log onto webmail, a shopping site, or...

Math, 5 months ago

with the help of HCF find the LCM of the following numbers 256and528...

Accountancy, 11 months ago

what is the objective of valuation of shares...

English, 11 months ago

fill the preposition. Ican do this work.......2 o' clock...

English, 11 months ago

what is divide in noun form...