Question

*Q1. You have the following sequence on a plasmid:
5′- ATGCTAGCAGAATTCTAGCTACGAT (only one of the strands is shown)
You cleave the region indicated (in bold) with the appropriate restriction enzyme, then fill in the overhangs with DNA polymerase, ligate, and reclone. You then aliquot the resulting DNA to three. In the first tube, digest the plasmid DNA with XmnI (recognition sequence GAANN/NNTTC), the second tube with Tsp509I (recognition sequence/AATT), and the third tube with AseI (recognition sequence AT/TAAT). What would be the restriction products in each tube?

Answer 1

Answer:

please let as brainliest